| TestCasesAlign |
test cases for Sequence alignment
|
| TestCasesAnnParse |
Test case for parsing ANN fields
|
| TestCasesApplyDel |
Test cases: apply a variant (DEL) to a transcript
|
| TestCasesApplyIns |
Test cases: apply a variant (INS) to a transcript
|
| TestCasesApplyMixed |
Test cases: apply a variant (MIXED) to a transcript
|
| TestCasesApplyMnp |
Test cases: apply a variant (MNP) to a transcript
|
| TestCasesApplySnp |
Test cases: apply a variant (SNP) to a transcript
|
| TestCasesBase |
Base class for some test cases
|
| TestCasesBaseApply |
Test case
|
| TestCasesBinomial |
Test for Binomial distribution
|
| TestCasesBuild |
Test case
|
| TestCasesCds |
Test random SNP changes
|
| TestCasesChiSquare |
Test for Hypergeometric distribution and Fisher exact test
|
| TestCasesCircular |
Test cases for circular genomes
|
| TestCasesCochranArmitage |
Cochran-Armitage test statistic test case
|
| TestCasesCodonTable |
Codon tables
|
| TestCasesCytoBands |
Test case for cytobands
|
| TestCasesDel |
Test random DEL changes
|
| TestCasesDels |
Test random DEL changes
|
| TestCasesDnaNSequence |
|
| TestCasesDnaOverlap |
|
| TestCasesDnaSequence |
|
| TestCasesDnaSequenceByte |
|
| TestCasesEffectCollapse |
Test Splice sites variants
|
| TestCasesEffectCollapse2 |
Test case
|
| TestCasesFasta |
Test case for FASTA file parsing
|
| TestCasesFileIndexChrPos |
Test cases for file index (chr:pos index on files)
|
| TestCasesFisherExactTest |
Test for Hypergeometric distribution and Fisher exact test
|
| TestCasesGenePvalueList |
GenePvalueList statistics test case
|
| TestCasesGenomicSequences |
Test case
|
| TestCasesGenotypeVector |
Test cases for GenotypeVector class
|
| TestCasesHgvs |
Test case for basic HGV annotations
|
| TestCasesHgvsDnaDup |
Test case
|
| TestCasesHgvsDnaDupNegative |
Test cases for HGVS's 'dup' on the negative strand
|
| TestCasesHgvsExon |
Test random SNP changes
|
| TestCasesHgvsIntron |
Test random SNP changes
|
| TestCasesHgvsProtDup |
Test case
|
| TestCasesHypergeometric |
Test for Hypergeometric distribution and Fisher exact test
|
| TestCasesIns |
Test random SNP changes
|
| TestCasesIntergenic |
Test intergenic markers
|
| TestCasesIntervals |
|
| TestCasesIntervalTree |
Test case for interval tree structure
|
| TestCasesIntervalTreeArray |
Test case for interval tree structure
|
| TestCasesIntervalTreeOri |
Test case for interval tree structure
|
| TestCasesIntervalVariant |
Test random Interval Variants (e.g.
|
| TestCasesIntStats |
|
| TestCasesIubString |
|
| TestCasesJaspar |
Test case for Jaspar parsing
|
| TestCasesMarkerUtils |
|
| TestCasesMnps |
Test random SNP changes
|
| TestCasesNextProt |
|
| TestCasesNmers |
|
| TestCasesOverlap |
|
| TestCasesProteinInteraction |
Test cases for protein interaction
|
| TestCasesReactome |
Test Reactome circuits
|
| TestCasesSeekableReader |
Seekable file reader test case
|
| TestCasesSequenceIndexer |
|
| TestCasesSnps |
Test random SNP changes
|
| TestCasesSpliceRegion |
Test Splice sites variants
|
| TestCasesSpliceSite |
Test Splice sites variants
|
| TestCasesStructuralDel |
Test case
Gene: geneId1
1:957-1157, strand: +, id:transcript_0, Protein
Exons:
1:957-988 'exon_0_0', rank: 1, frame: ., sequence: gttgcttgaatactgtatagccttgccattgt
1:1045-1057 'exon_0_1', rank: 2, frame: ., sequence: tgtgttgctaact
1:1148-1157 'exon_0_2', rank: 3, frame: ., sequence: agacatggac
CDS : gttgcttgaatactgtatagccttgccattgttgtgttgctaactagacatggac
Protein : VA*ILYSLAIVVLLTRHG?
|
| TestCasesStructuralDup |
Test case for structural variants: Duplications
|
| TestCasesStructuralInv |
Test cases for structural variants: Inversions
|
| TestCasesStructuralTranslocations |
Test case for structural variants: Translocation (fusions)
|
| TestCasesVariantDecompose |
Test cases: apply a variant (MIXED) to a transcript
|
| TestCasesVariantRealignment |
Test cases for variant realignment
|
| TestCasesVcf |
VCF parsing test cases
|
| TestCasesZzz |
Test playground
|
| TestGenome |
Creates a simple "genome" for testing:
|