Class TestCasesStructuralDel
- java.lang.Object
-
- org.snpeff.snpEffect.testCases.unity.TestCasesBase
-
- org.snpeff.snpEffect.testCases.unity.TestCasesStructuralDel
-
public class TestCasesStructuralDel extends TestCasesBase
Test case Gene: geneId1 1:957-1157, strand: +, id:transcript_0, Protein Exons: 1:957-988 'exon_0_0', rank: 1, frame: ., sequence: gttgcttgaatactgtatagccttgccattgt 1:1045-1057 'exon_0_1', rank: 2, frame: ., sequence: tgtgttgctaact 1:1148-1157 'exon_0_2', rank: 3, frame: ., sequence: agacatggac CDS : gttgcttgaatactgtatagccttgccattgttgtgttgctaactagacatggac Protein : VA*ILYSLAIVVLLTRHG?1 0 1 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567 gttgcttgaatactgtatagccttgccattgt........................................................tgtgttgctaact..........................................................................................agacatggac V A * I L Y S L A I V V L L T R H G 01201201201201201201201201201201 2012012012012 0120120120 >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>-------------------------------------------------------->>>>>>>>>>>>>------------------------------------------------------------------------------------------>>>>>>>>>> | | | | | | | | | | | ^1157 | | | | ^1148 | | | ^1057 | | ^1045 | ^988 ^957
Gene: geneId2 1:2066-2141, strand: +, id:transcript_1, Protein Exons: 1:2066-2069 'exon_1_0', rank: 1, frame: ., sequence: actt 1:2084-2089 'exon_1_1', rank: 2, frame: ., sequence: cccttt 1:2116-2126 'exon_1_2', rank: 3, frame: ., sequence: tacgcccacgt 1:2133-2141 'exon_1_3', rank: 4, frame: ., sequence: ccgccgctg CDS : acttcccttttacgcccacgtccgccgctg Protein : TSLLRPRPPL
1 7 8 9 0 1 2 3 4 6789012345678901234567890123456789012345678901234567890123456789012345678901 actt..............cccttt..........................tacgcccacgt......ccgccgctg T S L L R P R P P L 0120 120120 12012012012 012012012 >>>>-------------->>>>>>-------------------------->>>>>>>>>>>------>>>>>>>>> | | | | | | | | | | | | | | | ^2141 | | | | | | ^2133 | | | | | ^2126 | | | | ^2116 | | | ^2089 | | ^2084 | ^2069 ^2066
-
-
Field Summary
-
Fields inherited from class org.snpeff.snpEffect.testCases.unity.TestCasesBase
addUtrs, BASE_DIR, chromoBases, chromoSequence, chromosome, codonTable, config, debug, gene, genome, genomeName, maxExons, maxGeneLen, maxTranscripts, minExons, numGenes, onlyMinusStrand, onlyPlusStrand, prefixes, rand, randSeed, shiftHgvs, snpEffectPredictor, spliceRegionExonSize, spliceRegionIntronMax, spliceRegionIntronMin, testType, transcript, verbose
-
-
Constructor Summary
Constructors Constructor Description TestCasesStructuralDel()
-
Method Summary
All Methods Instance Methods Concrete Methods Modifier and Type Method Description protected voidcheckEffects(Variant variant, EffectType[] expEffs, java.lang.String[] expHgvsp, java.lang.String[] expHgvsc, VariantEffect.EffectImpact expectedImpact, java.lang.String[] expAnns)protected voidinit()voidtest01_delGene()Deletion Whole gene / whole transcriptvoidtest01_delTr()Deletion Whole gene / whole transcriptvoidtest02()Deletion One coding exonvoidtest03()Deletion two coding exons (within the same gene)voidtest04()Deletion Part of one coding exonvoidtest05()Deletion Part of two coding exons (within the same gene)voidtest06()Deletion one genes and part of another genevoidtest07()Deletion after gene's coding region (LOW impact)voidtest08()Deletion Part of two genes cutting on intronsvoidtest09()Deletion Part of two genes cutting exonsvoidtest10()Deletion Intron-
Methods inherited from class org.snpeff.snpEffect.testCases.unity.TestCasesBase
after, before, checkApply, checkApplyDel, checkApplyIns, checkApplyMixed, checkApplyMnp, checkApplySnp, checkEffect, checkEffect, formatVersion, hasEffect, initRand, initSnpEffPredictor, initSnpEffPredictor, path, pathClassName, prependSequenceToFirstExon
-
-
-
-
Method Detail
-
checkEffects
protected void checkEffects(Variant variant, EffectType[] expEffs, java.lang.String[] expHgvsp, java.lang.String[] expHgvsc, VariantEffect.EffectImpact expectedImpact, java.lang.String[] expAnns)
-
init
protected void init()
- Overrides:
initin classTestCasesBase
-
test01_delGene
@Test public void test01_delGene()
Deletion Whole gene / whole transcript
-
test01_delTr
@Test public void test01_delTr()
Deletion Whole gene / whole transcript
-
test02
@Test public void test02()
Deletion One coding exon
-
test03
@Test public void test03()
Deletion two coding exons (within the same gene)
-
test04
@Test public void test04()
Deletion Part of one coding exon
-
test05
@Test public void test05()
Deletion Part of two coding exons (within the same gene)
-
test06
@Test public void test06()
Deletion one genes and part of another gene
-
test07
@Test public void test07()
Deletion after gene's coding region (LOW impact)
-
test08
@Test public void test08()
Deletion Part of two genes cutting on introns
-
test09
@Test public void test09()
Deletion Part of two genes cutting exons
-
test10
@Test public void test10()
Deletion Intron
-
-