Uses of Class
org.snpeff.interval.Gene

Packages that use Gene

Package	Description
org.snpeff.geneSets
org.snpeff.interval
org.snpeff.snpEffect
org.snpeff.snpEffect.factory
org.snpeff.snpEffect.testCases.integration
org.snpeff.snpEffect.testCases.unity
org.snpeff.stats
org.snpeff.svg
org.snpeff.vcf

Uses of Gene in org.snpeff.geneSets

Methods in org.snpeff.geneSets with parameters of type Gene

Modifier and Type	Method	Description
void	GeneStats.add(Gene gene)
void	GeneStats.add(Gene gene, boolean useGeneId)	Add a gene, update statistics

Uses of Gene in org.snpeff.interval

Methods in org.snpeff.interval that return Gene

Modifier and Type	Method	Description
Gene	Gene.circularClone()	In a circular genome, a gene can have negative coordinates or crosses over chromosome end.
Gene	Gene.cloneShallow()
Gene	Genes.get(java.lang.String geneId)	Obtain a gene interval
Gene	Transcript.getGene()
Gene	Genes.getGeneByName(java.lang.String geneName)	Obtain a gene by GeneName WARNING: The first match is returned.

Methods in org.snpeff.interval that return types with arguments of type Gene

Modifier and Type	Method	Description
java.util.List<Gene>	Genome.getGenesSorted()	Create a sorted list of genes (sorted by gene Id)
java.util.List<Gene>	Genome.getGenesSortedPos()	Create a sorted list of genes (sorted by genomic position)
java.util.Iterator<Gene>	Genes.iterator()
java.util.Collection<Gene>	Genes.sorted()
java.util.Collection<Gene>	Genes.values()

Methods in org.snpeff.interval with parameters of type Gene

Modifier and Type	Method	Description
void	Genes.add(Gene gene)	Add a gene interval to this collection
static Intergenic	Intergenic.createIntergenic(Gene geneLeft, Gene geneRight)	Creates an intergenic marker based on the "space" between two genes

Constructors in org.snpeff.interval with parameters of type Gene

Constructor	Description
Transcript(Gene gene, int start, int end, boolean strandMinus, java.lang.String id)

Uses of Gene in org.snpeff.snpEffect

Methods in org.snpeff.snpEffect that return Gene

Modifier and Type	Method	Description
Gene	SnpEffectPredictor.getGene(java.lang.String geneId)	Obtain a gene by geneId
Gene	VariantEffect.getGene()
Gene	VariantEffectFusion.getGene()
Gene	VariantEffectStructural.getGene()
Gene	VariantEffectFusion.getGeneLeft()
Gene	VariantEffectFusion.getGeneRight()
Gene	SnpEffectPredictor.queryClosestGene(Marker inputInterval)	Find closest gene to this marker

Methods in org.snpeff.snpEffect that return types with arguments of type Gene

Modifier and Type	Method	Description
java.util.List<Gene>	VariantEffect.getGenes()
java.util.List<Gene>	VariantEffectStructural.getGenes()

Methods in org.snpeff.snpEffect with parameters of type Gene

Modifier and Type	Method	Description
void	SnpEffectPredictor.add(Gene gene)	Add a gene interval

Uses of Gene in org.snpeff.snpEffect.factory

Methods in org.snpeff.snpEffect.factory that return Gene

Modifier and Type	Method	Description
protected Gene	SnpEffPredictorFactoryGff.addGene(GffMarker gffMarker)
protected Gene	SnpEffPredictorFactoryGff.addGene(GffMarker gffMarker, boolean findNextGeneId)	Create and add a gene based on GffMarker
protected Gene	SnpEffPredictorFactory.findGene(java.lang.String id)
protected Gene	SnpEffPredictorFactory.findGene(java.lang.String geneId, java.lang.String id)
protected Gene	SnpEffPredictorFactoryGff.findOrCreateGene(GffMarker gffMarker)	Find or create a gene based on GffMarker

Methods in org.snpeff.snpEffect.factory with parameters of type Gene

Modifier and Type	Method	Description
protected void	SnpEffPredictorFactory.add(Gene gene)	Add a Gene

Uses of Gene in org.snpeff.snpEffect.testCases.integration

Fields in org.snpeff.snpEffect.testCases.integration declared as Gene

Modifier and Type	Field	Description
protected Gene	TestCasesHgvsBase.gene

Uses of Gene in org.snpeff.snpEffect.testCases.unity

Fields in org.snpeff.snpEffect.testCases.unity declared as Gene

Modifier and Type	Field	Description
protected Gene	TestCasesBase.gene
Gene	TestGenome.gene

Methods in org.snpeff.snpEffect.testCases.unity with parameters of type Gene

Modifier and Type	Method	Description
protected void	TestCasesStructuralInv.checkEffects(Variant variant, EffectType[] expEffs, java.lang.String[] expHgvsc, VariantEffect.EffectImpact expectedImpact, java.lang.String[] expAnns, Gene[] genesToAdd)
protected void	TestCasesBase.initSnpEffPredictor(Gene[] genesToAdd)	Create a predictor For the default parameters the first predictor created has only one transcript: 1:880-1001, strand: +, id:transcript_0, Protein Exons: 1:880-1001 'exon_0_0', rank: 1, frame: ., sequence: taaccccatatgattagtacggtagaggaaaagcacctaacccccattgagcaggatctctttcgtaatactctgtatcgatgaccgatttatttgattccccacatttatttcatcggga CDS : taaccccatatgattagtacggtagaggaaaagcacctaacccccattgagcaggatctctttcgtaatactctgtatcgatgaccgatttatttgattccccacatttatttcatcgggac Protein : *PHMISTVEEKHLTPIEQDLFRNTLYR*PIYLIPHIYFIG?

Uses of Gene in org.snpeff.stats

Methods in org.snpeff.stats with parameters of type Gene

Modifier and Type	Method	Description
double	ObservedOverExpected.expected(Gene g)	Expected number of sequences (average between plus and minus strand)
int	ObservedOverExpected.observed(Gene g)	Observed sequence (average between plus and minus strand)
double	ObservedOverExpected.oe(Gene g)	Observed over expected ratio
void	GeneCountByTypeTable.sample(Gene gene, Transcript tr, java.lang.String type, VariantEffect variantEffect)	Sample this tuple to update statistics

Uses of Gene in org.snpeff.svg

Constructors in org.snpeff.svg with parameters of type Gene

Constructor	Description
SvgGene(Gene gene, Svg svg)

Uses of Gene in org.snpeff.vcf

Constructors in org.snpeff.vcf with parameters of type Gene

Constructor	Description
VcfLof(Gene gene, double percentAffected)
VcfNmd(Gene gene, double percentAffected)